lunes, 6 de octubre de 2008

Chistes infantiles, chistes para chicos, chistes para el recreo

Chistes infantiles, chistes para chicos, chistes para el recreo

Porque los mas chicos tambien tienen derecho a la risa, les dejamos una serie de chistes que los tienen como protagonistas.

Un niño entra a una óptica y le dice al vendedor:
- Quiero comprar una gafas, por favor.
El vendedor le pregunta:
- ¿Para el sol?
Y el niño responde:
- No. ¡Para mí!

Suena el teléfono en la escuela:
- ¿Alo?
- ¿Si? ¡Buenos días!
- Mi niño hoy no pudo ir a la escuela porque estaba enfermo.
- ¿Ah sí? ¿Y con quién hablo?
- Con mi papá.

En el cole la profesora pregunta:
- María, dime un apalabra que tenga muchas “o”.
Y María responde:
-Goloso, profe.
- Muy bien, María. Ahora tú Pepito.
Pepito se queda pensando y dice…

Caperucita Roja va por el bosque, se encuentra al lobo feroz y él le pregunta:
- ¿A donde vas niña?,
Y ella le dice: - ¡A usted que le importa!
Y él dice: - como ha cambiado este cuento.

Un niño le pregunta a su madre:
- Mamá, mamá, que tienes en la barriga?
-Es un bebé hijo.
Y lo quieres mucho?
-Si hijo, lo quiero mucho.
Ahm… ¿Y por qué te lo comiste?

- ¡papá! ¡papá!, ¿los marcianos son amigos o enemigos?
- ¿Por qué lo preguntas hijo?
- Por que se han llevado a la abuela.
- Pues, en ese caso son amigos.

¿Sabes que mi hermano anda en bicicleta desde los cuatro años?
- Mmm, ya debe estar lejos.

En la escuela, la maestra dice:
A ver Luis, ¿cómo te imaginas la escuela ideal?
¡Cerrada, maestra!

¡Mama! ¡Mama! en el colegio me dicen fin de semana.
¿Por qué Domingo?

Luego de una persecución el policía coge al ladrón y le pregunta:
- ¿Por qué le robó el reloj a la señora?
Y el ladrón contesta:
- Yo no le robé ningún reloj, ella me lo dio.
- ¿En qué momento ella le dio el reloj?
- En el momento que le mostré la pistola.

- Mamá mamá que buena esta la paella.
- Pues repite hijo, repite.
- Mamá mamá que buena está la paella.

76 comentarios:

cristian dijo...

un chico anda en bicicleta y le dice a la mamá:
mamá mamá!, mira con una mano.
mamá mamá!, mira sin manos.
mamá mamá!, mira sin dientes.

iaruchy_k-p_ dijo...

elias dijo:mama mama en el colegio me dicen fin de semana
¿porque domingo?

iaruchy_k-p_ dijo...

era tan fea cuando la mama le tenia q dar el pecho le daba la espalda.

era tan fea que cuando fue a un concurso de feas le dijieron que no aceptaban profecionales.

era tan fea que cuando me llego una foto de ella en el e-mail me aparecio el anti virus.

florencia dijo...

a las 3 de la mañana...
mamá mamá! ¿puedo ir al baño?si...
el nene sale del baño y la mama le dice:pesado ,en el baño a las 3 de la mañana ;y elnene responde:era tan pero tan pesado el nene ,que rompió el inodoro.

Este comentario ha sido eliminado por el autor.
sol dijo...

hola este es un chiste para los chiquisss...

Una mujer le pregunta a su amiga:
-¿como anda tu hijo en su nuevo trabajo?
-y que hace
- NADA...

sol dijo...

otroo chisteee... para mis amiguitos...


tamu99 dijo...

¿cual es el país que ríe y explota?


tamu99 dijo...

¿cual es la mitad de 1(uno)?


tamu99 dijo...

¿Que le dijo un sapo a el otro?


tamu99 dijo...

¡Mozo, mozo, en mi sopa hay una rata!

No se asuste, señora , ¿no ve que está muerta?

tamu99 dijo...

¿Por que el pollo cruzó la calle?


tamu99 dijo...

Un día de calor va un enano a tomar un jugo a un bar, pegando pequeños saltos decia:
un jugo por favor , un jugo por favor;al ver que nadie le prestaba atención enojado decide ir por el costado de la barra donde había una purtita y observo que del otro lado de la barra había otro enano que preguntaba dando pequeños saltos :
¿de naranja o de manzana?

Melina Parodi dijo...

ls djo un chist!!!

mama mama en la escuelaa aprendi q el mundo da vueltas!!
-que bien hijo mio; me irias a comprar una soda???
-si mama
el niño fue y durante horas no volvia entonces la mama se asomo x la ventana y vio al niño sentado en la escalera, salio afuera y l pregunto:que haces??
-como el mundo da vueltas estoy esperando que pase un almacen por aqui.

elena dijo...

habia un nino tan bajito tan bajito q su kbeza olia a pies...

Biancuchi dijo...

tengo 11 asique no pasa nada jajja
che sabias que mi mamá se cayo del 4 piso y se fue al cielo :(
uy como rebota tu vieja eeehhh

Mario dijo...

qué le dice un pelo a un calvo :
no te muevas que me caigo.

Mario dijo...

este es un niñó que le pregunta a su madre:
mamá , mamá , puedo ver la tele ?
y la madre responde :
Vale , pero apagada.

Mario dijo...

había un incendio en un piso y llegan los bomberos y dice uno :
yo voy a intentar apagar el fuego .
y otro dice..:
yo voy a ir diciendo a la gente que se tire de la terraza y yo les voy cogiendo.
llega uno , y le coge , llega otro y otro y otro y les coge y llega un negro y le dice el bombero al negro :
a tí no te cogo que ya estás quemado.

emi laborde dijo...

do you spik in english
como dise señor
do you spik in english
no lo entiendo
que si usted abla ingles
a ¡si! perfectamente

este es para las pibas

emi laborde dijo...

era tan feo que para salir a la calle levantaba el telefono y le preguntaba quien era el nene mas lindo y el telefono sonaba tu tu tu tu tu

este es otro para las pibassssssss

emi laborde dijo...

un español le dice a un chino:
hola y el chino le contesta las 12 :30

otro mas para las pibas d d f i s j m d

Susana dijo...

jaja!! me encantaron los chistes para los nenes! en en año trabajo en un jardín pero hace 1 mes comencé en Kraft Argentina hasta que otra vez comiencen las clases.. creo que podría hacer una actividad con chistes así..
muchos saludos! el blog esta genial!

carlos alberto dijo...

deverian publicar este tambien
hay un raton y 10 gatos cuantos gatos se comerian al raton
2 porque 8 de cada 10 gatos
prefieren wiskas.

Viri dijo...

yo soy lunizs

que es un punto rosa en medio de la tierra
una hormiga quinciañera

Viri dijo...

este es un chiste para peques

que es un punto en un ataud

un puntomuerto

tomaszarza dijo...

hay una chica nueva en el colegio y pepito le dice ¿como te llamas? belinda pero decime be perque de linda no tengo nada pepito va a l casa del papa y le dice papa hay una chica nueva en el colegio y como se llama mmm... perdon me lo olvide
pepito va a la escuela y le pregunta a belinda amiga ¿como te llamas? belinda pero decime be por que de linda no tengo nada si no me decis mañana te corto el pito dice el papa
pepito va al colegio y le pregunta a belinda pero decime be por que de linda no tengo nada
pepito va a la casa y el papa le dice ¿como se llama tu compañera del cole? mmmmm... perdon me lo olvide y despues el papa le corta el pito pepito va al colegio y le dice a belinda. Amiga ¿como te llamas?belinda pero decime be por que de linda no tengo nada y belinda le pregunta a pepito ¿y vos como te llamas? pepito pero decime pe porque de pito no tengo nada jajajajaaajajaja porque el papa le locortooo el pitooo!!! jajajaj esta muy buenoooo

tomaszarza dijo...

aguante sanlorenzoooooo!!!!

javiera rayen quezada flores dijo...

¿Qué le regalo batman a su mamá en su cumpleaños?
R: una Batidora

javiera rayen quezada flores dijo...

eran dos niños en una sala de historia y ubo le pregunta al otro:
Nunca pence que Albert Einstain era tan feo
y el otro le dice:
si es feo imagenate lo feo que era su hermano Franck

javiera rayen quezada flores dijo...

¿A donde van los gatos cuando quieren tener unas vacaciónes con mucha acción?
R: a las islas canarias

javiera rayen quezada flores dijo...

¿Cuál es la vocación artistica preferida de la vaca?
R: la Muuuuuucica

oihane dijo...

va un señor en una discoteca y le cice a una señora
- y eso
-eso es mi amiga y tampoco vaila.

Albina dijo...

Hola Aqui os dejo unos chistes... :

Mama, mama en el colegio me llaman peludo.!
-Cariño, me esta hablando el perro.

Aki otro...

Va una niña y se mira al espejo..
Al cabo de unos minutos dice:
-Oh dios,mio!! Estoy mas fea, que un calvo despeinado!! :)

liliana dijo...

papa, papa, vinieron a preguntar si aqui vendian un burro¡ y que les respondistes, hijo?, que no estabas, jajajajaj, ¡buena verdad¡

Simona__01 dijo...

Dos gemelos le dicen a la mama: mama mama en la escuela nos dicen FIN DE SEMANA!!! ¬¬ ¿Porqe sera Sabado? Vos Domingo sabes!?

luis gutierrez dijo...

en que se parece las pompas a las cantinas

en que los dos salen pedos

angelita dijo...

¿ que le dice un tamarindo a otro tamarindo?
-Por mi pulpa por mi pulpa.

Mariana01 dijo...

¿Que le dijo una llanta a otra llanta?
(si quieres saaver solo baja la escalera es muyyy interesante lo que dicen)

-Nada porque las llantas no hablan!

Habia un señor pero ta pero tan gordo! que... se caia de los 2 lados de la cama :)


barbara arriagada veas dijo...

Había una vez una Cuchara, un Tenedor y un Cuchillo; la Cuchara iba más adelante que el Cuchillo y el Tenedor, y el Tenedor le dice al Cuchillo:--¿por qué no llamas a la cuchara?--, y el Cuchillo dice:--¡Cuchara, Cuchara, Cuchara!--y el Tenedor le dice:--Parece que no es-cuchara

pablozd chido dijo...

qule dijo un pollo malo a un pollo bueno
caldito seas

FINA NAVIO dijo...

un chino se fue a un hotel tres dias y al primer dia un perro guaaaaaaaaaauuuuuu!!!! al siguiente dia otro perro guuuaaaaaaauuu!!!!!! i al tercer dia otro perro ggggguuuuuuuuaaaaaauuuuuuuuu!!!!!!! y llama a la policia i le dice ahi unos pelos del culo que no me dejan empaz y le dice el policia afeiteselos guarro!!!!!!!!!!

FINA NAVIO dijo...

un niño le dice a la profesora ya estoy del trabajito y la profesora le dice pues tira de la cadena

FINA NAVIO dijo...


Fabiana Sarai Masis Mendez dijo...

Como se dice espejo en chino:
Ai toy jajajjaj. ;-)

Fabiana Sarai Masis Mendez dijo...

En el colegio le dice la prof :
Maria dimuna palabra que tennpga muchas [o]
Dice Maria:GOLOSO.
Muy bien y haora tu pepito.
Y se quedo pensando pepito un tiempony despues dice:GOOOOOOOOOOOOOOOL:D

daniel camachito dijo...

Que le dice una una plancha a otra plancha !!!!!! Vamos ha plachar

Maria Aguilar Ruiz dijo...

Aqui va un chiste avia un senor boracho y ve a una senora fea y le dice el boracho vieja fea y la senora le dice a el boracho viejo boracho y le contesta el boracho si pero se me quita manana

Dionisia Gomes dos Santos dijo...

un tipo se compro una moto y se la fue a enseñar a un amigo del que era gago,y el gago le dijo
vamos a enséñasela a javiel y javiel dijo ei loco que moto tan jebi y ban a 80 bun bun jajaja a 100 bun bun jajaja a 120 bun bun jaja porque te ries gago jajabiel se callo

Dionisia Gomes dos Santos dijo...

un tipo se compro una moto y se la fue a enseñar a un amigo del que era gago,y el gago le dijo
vamos a enséñasela a javiel y javiel dijo ei loco que moto tan jebi y ban a 80 bun bun jajaja a 100 bun bun jajaja a 120 bun bun jaja porque te ries gago jajabiel se callo

Norev Durok dijo...

un ladron va a entrar a robar una casa cuando escucha:¡Jesus te esta mirando!, el ladron se asusta, pero cuando ve que no pasa nada sigue con lo suyo y vuelve a escuchar:¡Jesus te esta mirando!, el ladron prende la luz y ve a un loro.
ladron: ¿como te llamas lorito?
loro: me llamo Pedro
ladron: Pedro es un nombre raro para un loro
loro: y Jesús es un nombre raro para un rottweiler

Alejandra Beltran dijo...

habia un niñito que se llamaba tarea profesora le dice a la clase ya alumnos tarea para la casa y el se paro y se fue jajajajajaja....

Alexa Sander dijo...

mama porque no follas nolo se papa por que estas ciego no lo se papa ya se por que no follas par que cuando se la ballas a meter a la mama se la metes por el muslo enberde por el coño la polla polla polla polla se mete por el coño ha ha ha ha ha ha ha ha ha ha ha ha ha ha xDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxD xDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxDxD

Francisco Javier Garcia Garrido dijo...

un niño se sube a un auto bus y pregunta:
- cuanto cuesta el bus?
- 50 cent
- que barato, bajens todos que me lo llevo

mama, mama que buena esta la comida, pues repite hija repite, mama que buena esta la comida
jajajajaja espero que se rian mucho, yo lo hize

Ana VR dijo...

Aquí OS dejo un chiste malisisisisisisisisisismo

Esto ha un burro. Se cae del cielo jaaaajjaaaajjajjjjajajajjajajajajajjaáá

Marta Báez dijo...

El mejor:

¿Qué le dice el gato a la pistola?

¿Qué tal tu gatillo?


¿Qué es un filósofo?
Es una persona ciega en una habitación a oscuras que busca un sombrero negro que no existe

corintios13 dijo...

soy santiago, hay una manzana eperando el autobus, y viene una banana y le pregunta a la manzana:

sol luciana dijo...

Hola soy Rocio aca Van Algunos Muy Graciosos:
-Olle Papá, ¿que se siente tener un hijo tan guapo?
-Hya no lo se hijo, preguntale a tu abuelo.
-Hola, me llamo Maria, diganme Mari
-Hola, me llamo Carolina, diganme Caro
-Hola me llamo Penelope, diganme...PENELOPE

-Hey, amigo ¿estas gordo?

-Hola mi amor, te quieor dar un matri-mono.
-Me das un mono?
- NO, Matri-mono.

-Muy bien, alumno digame la 5ta letra del abcdario.

-Señorita, usted me retaria por algo que no hice?
-No, porsupuesto que no-
-Entonces, no me reta si no hice la tarea?

Hay una pizza llorando en un cementerio, se acerca otra y le pregunta:
-Era familiar?
-No, Mediana.

Que tienen en común los hombres y las medias?

La profe dice:
-alumnos si hoy se portan bien mañana vengo en minifalda.
Los chcios se portan bien, al día siguiente laprofe viene en minifalda y dice:
-Chicos si hoy se portan bien mañana vengo en bikyni
se portan bien de nuevo y la profe al otro día viene en bikyniy dice:
-si hoy se portan bien mañana vengo en hojita.
se portan bien y la seño viene en hojita. a la salida Juan se queda esperando y la profe le pregunta:
-¿que esta esperando Juan?
-ah que llegue el otoño.

¿Qué le dice una impresora a otra?
¿Esta hoja es tuya o es impresión mía?

Bueno muchas gracias, si les gustaro mis chisten entren a mi blog solo copien y pegue:

color rosado dijo...

Papá papá en el colegio me dicen pie grande, no le hagas caso pero saca tu zapatilla del garaje porque tengo que estacionar el auto

color rosado dijo...

Llega la profesora de Jaimito a clase y dice:
- A ver, quiero que me digáis cosas que sean redondas y con pelos.
Fernandito responde:
- Las pelotas de tenis.
- Muy bien - dice la profesora -. A ver tú, Pepito.
- Los cocos, señorita.
- Muy bien, muy bien.
A eso que Jaimito alza la mano.
- A ver Jaimito, dime.
- Las pelotas de billar.
- Jaimito, las pelotas de billar son redondas pero no tienen pelo.
Y dice Jaimito:
- ¿Cómo que no?. A ver, Billar, enséñale las pelotas a la profesora.

color rosado dijo...

El profesor le entrega a Jaimito una pata de pájaro y le dice:
- Viendo esta extremidad, dígame la familia, el género y la especie del animal, así como sus costumbres migratorias y el número de crías por nidada.
- Pero, ¿cómo le voy a decir todo eso con una sola pata?.
- ¡Está usted suspendido!. A ver dígame su nombre y apellido.
Jaimito se quita un zapato, le enseña el pie desnudo al profesor y le dice:
- Adivine...

soofi alonso! dijo...

-usted la ruviaa!
-quien yo??
-si usted no hay otra
-que sucede??
-le informamos que su avion viene demorado!!
-aaaah! es mi color favoritoooo!

carlos terrones dijo...

le dice jaimito a su profesora :profesora usted me castigaría por no hacer algo y ella le dice: como crees jaimito no te castigaría y el le responde: a que bueno profesora porque no hice mi tarea

carlos terrones dijo...

le dice jaimito a su profesora :profesora usted me castigaría por no hacer algo y ella le dice: como crees jaimito no te castigaría y el le responde: a que bueno profesora porque no hice mi tarea

Julia Martirena dijo...

Jaja muy buenos chistes y los cometarios tambien yo tengo un chiste:

Unknown dijo...


Javiera Bueno dijo...

Había una vez un perro que se llamaba peo una vez se callo a un ollo y le dijo a un señor:señor,señor saqueme el peo del ollo

Habia una vez un gato que se tomo una taza de gasolina corrio hasta la esquina y adivinen mientras bajan la escalera
R: se le acabo la gasolina

nancy nidia munoz dijo...
Este comentario ha sido eliminado por el autor.
Jhonatan Guevara .V dijo...

-mamá quiero tener una novia
-la mamá responde porque hijo?
-porque todos mis amigos tienen
-la mamá le dice: si tus amigos se lanzan al rio tu harias lo mismo?
-no me quedaría con sus novias

Paola dijo...

Que le dice un árbol a otro árbol adivinen mientras viajan la escalera
R- Ya nos dejaron plantados Jejeje

Paola dijo...

Que le dice un árbol a otro árbol adivinen mientras viajan la escalera
R- Ya nos dejaron plantados Jejeje

Ezelook dijo...

Hola a todos aki hay un chiste cool :

La profe dice, mañana voy a tomar las tablas de multiplicar, Jaimito que nunca estudiaba se hiso un machete en el forro del guardapolvo. Llegó el día, y rl turno de Jaimito -a ver Jaimito ¿cuánto es 3x4?-
Jaimito espía el machete -12, profe-
- bien ¿y 6x5?-
Jaimito espía- 20,profe-
-Bien, la ultima,100x100-
Jaimito espía- ALGODÓN-

Patricia Aragón Martin dijo...

por que el mar es azul
porque los peces hacen blue blue

nuriko yaoi dijo...

Cual es el colmó de un jardinero.....
Que su hija se llame Rosa y la deben plantada

Aly dijo...

Había una mujer tan alta tan alta tan alta que se cayo el jueves y aterrizó el domingo

Gloria Lopez Avila dijo...

No es por nada he pero 6x5 es 30